CRISTA Logo
CRISPR Target Assessment

HOME      sgRNA::DNA SCORE      FIND OFF-TARGETS      RANK TARGETS IN GENE      DOWNLOAD

Download CRISTA

A source code for download is available here.

The code can be used to assess cleavage propensity of a genomic site by an sgRNA, according to CRISTA predictions.
CRISTA computes various features of the genomic content and the applied sgRNA, that depend on the availability of large resources. Therefore, the source code for download is adapted for offline usage. This version accounts for less features and provides slightly reduced accuracy.
The downloadable version averages the results over fewer repetitions of the model, to allow easy usage.
However, you are welcome to create input files as instructed and use the full model on the online web server for assessment.

Input:
sgRNA: a 20-nt long sequence
Genomic target: the 23-nt sequence must be surrounded by 3 additional nucleotides at each end

Usage example:
python CRISTA.py   -s  CTCAGCTGAGGTTGCTGCTG    -d  GGCCTCAGCTGAGGTTGCTGCTGTGGAAG

Dependencies:
- Python 3.
- Modules: numpy, sklearn, pickle, and argparse.